29
Nov
2009
admin

FASTA DNA (unaligned)


>Cow
ATGGCATATCCCATACAACTAGGATTCCAAGATGCAACATCACCAATCATAGAAGAACTACTTCACTTTCATGAC
CACACGCTAATAATTGTCTTCTTAATTAGCTCATTAGTACTTTACATTATTTCACTAATACTAACGACAAAGCTG
ACCCATACAAGCACGATAGATGCACAAGAAGTAGAGACAATCTGAACCATTCTGCCCGCCATCATCTTAATTCTA
ATTGCTCTTCCTTCTTTACGAATTCTATACATAATAGATGAAATCAATAACCCATCTCTTACAGTAAAAACCATA
GGACATCAGTGATACTGAAGCTATGAGTATACAGATTATGAGGACTTAAGCTTCGACTCCTACATAATTCCAACA
TCAGAATTAAAGCCAGGGGAGCTACGACTATTAGAAGTCGATAATCGAGTTGTACTACCAATAGAAATAACAATC
CGAATGTTAGTCTCCTCTGAAGACGTATTACACTCATGAGCTGTGCCCTCTCTAGGACTAAAAACAGACGCAATC
CCAGGCCGTCTAAACCAAACAACCCTTATATCGTCCCGTCCAGGCTTATATTACGGTCAATGCTCAGAAATTTGC
GGGTCAAACCACAGTTTCATACCCATTGTCCTTGAGTTAGTCCCACTAAAGTACTTTGAAAAATGATCTGCGTCA
ATATTATAA
>Carp
ATGGCACACCCAACGCAACTAGGTTTCAAGGACGCGGCCATACCCGTTATAGAGGAACTTCTTCACTTCCACGAC
CACGCATTAATAATTGTGCTCCTAATTAGCACTTTAGTTTTATATATTATTACTGCAATGGTATCAACTAAACTT
ACTAATAAATATATTCTAGACTCCCAAGAAATCGAAATCGTATGAACCATTCTACCAGCCGTCATTTTAGTACTA
ATCGCCCTGCCCTCCCTACGCATCCTGTACCTTATAGACGAAATTAACGACCCTCACCTGACAATTAAAGCAATA
GGACACCAATGATACTGAAGTTACGAGTATACAGACTATGAAAATCTAGGATTCGACTCCTATATAGTACCAACC
CAAGACCTTGCCCCCGGACAATTCCGACTTCTGGAAACAGACCACCGAATAGTTGTTCCAATAGAATCCCCAGTC
CGTGTCCTAGTATCTGCTGAAGACGTGCTACATTCTTGAGCTGTTCCATCCCTTGGCGTAAAAATGGACGCAGTC
CCAGGACGACTAAATCAAGCCGCCTTTATTGCCTCACGCCCAGGGGTCTTTTACGGACAATGCTCTGAAATTTGT
GGAGCTAATCACAGCTTTATACCAATTGTAGTTGAAGCAGTACCTCTCGAACACTTCGAAAACTGATCCTCATTA
ATACTAGAAGACGCCTCGCTAGGAAGCTAA
>Chicken
ATGGCCAACCACTCCCAACTAGGCTTTCAAGACGCCTCATCCCCCATCATAGAAGAGCTCGTTGAATTCCACGAC
CACGCCCTGATAGTCGCACTAGCAATTTGCAGCTTAGTACTCTACCTTCTAACTCTTATACTTATAGAAAAACTA
TCATCAAACACCGTAGATGCCCAAGAAGTTGAACTAATCTGAACCATCCTACCCGCTATTGTCCTAGTCCTG
CTTGCCCTCCCCTCCCTCCAAATCCTCTACATAATAGACGAAATCGACGAACCTGATCTCACCCTAAAAGCCATC
GGACACCAATGATACTGAACCTATGAATACACAGACTTCAAGGACCTCTCATTTGACTCCTACATAACCCCAACA
ACAGACCTCCCCCTAGGCCACTTCCGCCTACTAGAAGTCGACCATCGCATTGTAATCCCCATAGAATCCCCCATT
CGAGTAATCATCACCGCTGATGACGTCCTCCACTCATGAGCCGTACCCGCCCTCGGGGTAAAAACAGACGCAATC
CCTGGACGACTAAATCAAACCTCCTTCATCACCACTCGACCAGGAGTGTTTTACGGACAATGCTCAGAAATCTGC
GGAGCTAACCACAGCTACATACCCATTGTAGTAGAGTCTACCCCCCTAAAACACTTTGAAGCCTGATCCTCACTA
CTGTCATCTTAA
>Human
ATGGCACATGCAGCGCAAGTAGGTCTACAAGACGCTACTTCCCCTATCATAGAAGAGCTTATCACCTTTCATGAT
CACGCCCTCATAATCATTTTCCTTATCTGCTTCCTAGTCCTGTATGCCCTTTTCCTAACACTCACAACAAAACTA
ACTAATACTAACATCTCAGACGCTCAGGAAATAGAAACCGTCTGAACTATCCTGCCCGCCATCATCCTAGTCCTC
ATCGCCCTCCCATCCCTACGCATCCTTTACATAACAGACGAGGTCAACGATCCCTCCCTTACCATCAAATCAATT
GGCCACCAATGGTACTGAACCTACGAGTACACCGACTACGGCGGACTAATCTTCAACTCCTACATACTTCCCCCA
TTATTCCTAGAACCAGGCGACCTGCGACTCCTTGACGTTGACAATCGAGTAGTACTCCCGATTGAAGCCCCCATT
CGTATAATAATTACATCACAAGACGTCTTGCACTCATGAGCTGTCCCCACATTAGGCTTAAAAACAGATGCAATT
CCCGGACGTCTAAACCAAACCACTTTCACCGCTACACGACCGGGGGTATACTACGGTCAATGCTCTGAAATCTGT
GGAGCAAACCACAGTTTCATGCCCATCGTCCTAGAATTAATTCCCCTAAAAATCTTTGAAATA
GGGCCCGTATTTACCCTATAG
>Loach
ATGGCACATCCCACACAATTAGGATTCCAAGACGCGGCCTCACCCGTAATAGAAGAACTTCTTCACTTCCATGAC
CATGCCCTAATAATTGTATTTTTGATTAGCGCCCTAGTACTTTATGTTATTATTACAACCGTCTCAACAAAACTC
ACTAACATATATATTTTGGACTCACAAGAAATTGAAATCGTATGAACTGTGCTCCCTGCCCTAATCCTCATTTTA
ATCGCCCTCCCCTCACTACGAATTCTATATCTTATAGACGAGATTAATGACCCCCACCTAACAATTAAGGCCATG
GGGCACCAATGATACTGAAGCTACGAGTATACTGATTATGAAAACTTAAGTTTTGACTCCTACATAATCCCCACC
CAGGACCTAACCCCTGGACAATTCCGGCTACTAGAGACAGACCACCGAATGGTTGTTCCCATAGAATCCCCTATT
CGCATTCTTGTTTCCGCCGAAGATGTACTACACTCCTGGGCCCTTCCAGCCATGGGGGTAAAGATAGACGCGGTC
CCAGGACGCCTTAACCAAACCGCCTTTATTGCCTCCCGCCCCGGGGTATTCTATGGGCAATGCTCAGAAATCTGT
GGAGCAAACCACAGCTTTATACCCATCGTAGTAGAAGCGGTCCCACTATCTCACTTCGAAAACTGGTCCACCCTT
ATACTAAAAGACGCCTCACTAGGAAGCTAA
>Mouse
ATGGCCTACCCATTCCAACTTGGTCTACAAGACGCCACATCCCCTATTATAGAAGAGCTAATAAATTTCCATGAT
CACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTA
ACACATACAAGCACAATAGATGCACAAGAAGTTGAAACCATTTGAACTATTCTACCAGCTGTAATCCTTATCATA
ATTGCTCTCCCCTCTCTACGCATTCTATATATAATAGACGAAATCAACAACCCCGTATTAACCGTTAAAACCATA
GGGCACCAATGATACTGAAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACA
AACGACCTAAAACCTGGTGAACTACGACTGCTAGAAGTTGATAACCGAGTCGTTCTGCCAATAGAACTTCCAATC
CGTATATTAATTTCATCTGAAGACGTCCTCCACTCATGAGCAGTCCCCTCCCTAGGACTTAAAACTGATGCCATC
CCAGGCCGACTAAATCAAGCAACAGTAACATCAAACCGACCAGGGTTATTCTATGGCCAATGCTCTGAAATTTGT
GGATCTAACCATAGCTTTATGCCCATTGTCCTAGAAATGGTTCCACTAAAATATTTCGAAAACTGATCTGCTTCA
ATAATTTAA
>Rat
ATGGCTTACCCATTTCAACTTGGCTTACAAGACGCTACATCACCTATCATAGAAGAACTTACAAACTTTCATGAC
CACACCCTAATAATTGTATTCCTCATCAGCTCCCTAGTACTTTATATTATTTCACTAATACTAACAACAAAACTA
ACACACACAAGCACAATAGACGCCCAAGAAGTAGAAACAATTTGAACAATTCTCCCAGCTGTCATTCTTATTCTA
ATTGCCCTTCCCTCCCTACGAATTCTATACATAATAGACGAGATTAATAACCCAGTTCTAACAGTAAAAACTATA
GGACACCAATGATACTGAAGCTATGAATATACTGACTATGAAGACCTATGCTTTGACTCCTACATAATCCCAACC
AATGACCTAAAACCAGGTGAACTTCGTCTATTAGAAGTTGATAATCGGGTAGTCTTACCAATAGAACTTCCAATT
CGTATACTAATCTCATCCGAAGACGTCCTGCACTCATGAGCCATCCCTTCACTAGGGTTAAAAACCGACGCAATC
CCCGGCCGCCTAAACCAAGCTACAGTCACATCAAACCGACCAGGTCTATTCTATGGCCAATGCTCTGAAATTTGC
GGCTCAAATCACAGCTTCATACCCATTGTACTAGAAATAGTGCCTCTAAAATATTTCGAAAACTGATCAGCTTCT
ATAATTTAA
>Seal
ATGGCATACCCCCTACAAATAGGCCTACAAGATGCAACCTCTCCCATTATAGAGGAGTTACTACACTTCCATGAC
CACACATTAATAATTGTGTTCCTAATTAGCTCATTAGTACTCTACATTATCTCACTTATACTAACCACGAAACTC
ACCCACACAAGTACAATAGACGCACAAGAAGTGGAAACGGTGTGAACGATCCTACCCGCTATCATTTTAATTCTC
ATTGCCCTACCATCATTACGAATCCTCTACATAATGGACGAGATCAATAACCCTTCCTTGACCGTAAAAACTATA
GGACATCAGTGATACTGAAGCTATGAGTACACAGACTACGAAGACCTGAACTTTGACTCATATATGATCCCCACA
CAAGAACTAAAGCCCGGAGAACTACGACTGCTAGAAGTAGACAATCGAGTAGTCCTCCCAATAGAAATAACAATC
CGCATACTAATCTCATCAGAAGATGTACTCCACTCATGAGCCGTACCGTCCCTAGGACTAAAAACTGATGCTATC
CCAGGACGACTAAACCAAACAACCCTAATAACCATACGACCAGGACTGTACTACGGTCAATGCTCAGAAATCTGT
GGTTCAAACCACAGCTTCATACCTATTGTCCTCGAATTGGTCCCACTATCCCACTTCGAGAAATGATCTACCTCA
ATGCTTTAA
>Whale
ATGGCATATCCATTCCAACTAGGTTTCCAAGATGCAGCATCACCCATCATAGAAGAGCTCCTACACTTTCACGAT
CATACACTAATAATCGTTTTTCTAATTAGCTCTTTAGTTCTCTACATTATTACCCTAATGCTTACAACCAAATTA
ACACATACTAGTACAATAGACGCCCAAGAAGTAGAAACTGTCTGAACTATCCTCCCAGCCATTATCTTAATTTTA
ATTGCCTTGCCTTCATTACGGATCCTTTACATAATAGACGAAGTCAATAACCCCTCCCTCACTGTAAAAACAATA
GGTCACCAATGATATTGAAGCTATGAGTATACCGACTACGAAGACCTAAGCTTCGACTCCTATATAATCCCAACA
TCAGACCTAAAGCCAGGAGAACTACGATTATTAGAAGTAGATAACCGAGTTGTCTTACCTATAGAAATAACAATC
CGAATATTAGTCTCATCAGAAGACGTACTCCACTCATGGGCCGTACCCTCCTTGGGCCTAAAAACAGATGCAATC
CCAGGACGCCTAAACCAAACAACCTTAATATCAACACGACCAGGCCTATTTTATGGACAATGCTCAGAGATCTGC
GGCTCAAACCACAGTTTCATACCAATTGTCCTAGAACTAGTACCCCTAGAAGTCTTTGAAAAATGATCTGTATCA
ATACTATAA
>Frog
ATGGCACACCCATCACAATTAGGTTTTCAAGACGCAGCCTCTCCAATTATAGAAGAATTACTTCACTTCCACGAC
CATACCCTCATAGCCGTTTTTCTTATTAGTACGCTAGTTCTTTACATTATTACTATTATAATAACTACTAAACTA
ACTAATACAAACCTAATGGACGCACAAGAGATCGAAATAGTGTGAACTATTATACCAGCTATTAGCCTCATCATA
ATTGCCCTTCCATCCCTTCGTATCCTATATTTAATAGATGAAGTTAATGATCCACACTTAACAATTAAAGCAATC
GGCCACCAATGATACTGAAGCTACGAATATACTAACTATGAGGATCTCTCATTTGACTCTTATATAATTCCAACT
AATGACCTTACCCCTGGACAATTCCGGCTGCTAGAAGTTGATAATCGAATAGTAGTCCCAATAGAATCTCCAACC
CGACTTTTAGTTACAGCCGAAGACGTCCTCCACTCGTGAGCTGTACCCTCCTTGGGTGTCAAAACAGATGCAATC
CCAGGACGACTTCATCAAACATCATTTATTGCTACTCGTCCGGGAGTATTTTACGGACAATGTTCAGAAATTTGC
GGAGCAAACCACAGCTTTATACCAATTGTAGTTGAAGCAGTACCGCTAACCGACTTTGAAAACTGATCTTCATCA
ATACTAGAAGCATCACTAAGA