29
Nov
2009
admin

NEXUS DNA


#nexus 
begin data;
dimensions ntax=10 nchar=705;
format datatype=dna interleave=yes gap=- missing=?;
matrix
Cow     ATGGCATATCCCATACAACTAGGATTCCAAGATGCAACATCACCAATCATAGAAGAACTA
Carp    ATGGCACACCCAACGCAACTAGGTTTCAAGGACGCGGCCATACCCGTTATAGAGGAACTT
Chicken ATGGCCAACCACTCCCAACTAGGCTTTCAAGACGCCTCATCCCCCATCATAGAAGAGCTC
Human   ATGGCACATGCAGCGCAAGTAGGTCTACAAGACGCTACTTCCCCTATCATAGAAGAGCTT
Loach   ATGGCACATCCCACACAATTAGGATTCCAAGACGCGGCCTCACCCGTAATAGAAGAACTT
Mouse   ATGGCCTACCCATTCCAACTTGGTCTACAAGACGCCACATCCCCTATTATAGAAGAGCTA
Rat     ATGGCTTACCCATTTCAACTTGGCTTACAAGACGCTACATCACCTATCATAGAAGAACTT
Seal    ATGGCATACCCCCTACAAATAGGCCTACAAGATGCAACCTCTCCCATTATAGAGGAGTTA
Whale   ATGGCATATCCATTCCAACTAGGTTTCCAAGATGCAGCATCACCCATCATAGAAGAGCTC
Frog    ATGGCACACCCATCACAATTAGGTTTTCAAGACGCAGCCTCTCCAATTATAGAAGAATTA

Cow     CTTCACTTTCATGACCACACGCTAATAATTGTCTTCTTAATTAGCTCATTAGTACTTTAC
Carp    CTTCACTTCCACGACCACGCATTAATAATTGTGCTCCTAATTAGCACTTTAGTTTTATAT
Chicken GTTGAATTCCACGACCACGCCCTGATAGTCGCACTAGCAATTTGCAGCTTAGTACTCTAC
Human   ATCACCTTTCATGATCACGCCCTCATAATCATTTTCCTTATCTGCTTCCTAGTCCTGTAT
Loach   CTTCACTTCCATGACCATGCCCTAATAATTGTATTTTTGATTAGCGCCCTAGTACTTTAT
Mouse   ATAAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTAT
Rat     ACAAACTTTCATGACCACACCCTAATAATTGTATTCCTCATCAGCTCCCTAGTACTTTAT
Seal    CTACACTTCCATGACCACACATTAATAATTGTGTTCCTAATTAGCTCATTAGTACTCTAC
Whale   CTACACTTTCACGATCATACACTAATAATCGTTTTTCTAATTAGCTCTTTAGTTCTCTAC
Frog    CTTCACTTCCACGACCATACCCTCATAGCCGTTTTTCTTATTAGTACGCTAGTTCTTTAC

Cow     ATTATTTCACTAATACTAACGACAAAGCTGACCCATACAAGCACGATAGATGCACAAGAA
Carp    ATTATTACTGCAATGGTATCAACTAAACTTACTAATAAATATATTCTAGACTCCCAAGAA
Chicken CTTCTAACTCTTATACTTATAGAAAAACTATCA---TCAAACACCGTAGATGCCCAAGAA
Human   GCCCTTTTCCTAACACTCACAACAAAACTAACTAATACTAACATCTCAGACGCTCAGGAA
Loach   GTTATTATTACAACCGTCTCAACAAAACTCACTAACATATATATTTTGGACTCACAAGAA
Mouse   ATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGATGCACAAGAA
Rat     ATTATTTCACTAATACTAACAACAAAACTAACACACACAAGCACAATAGACGCCCAAGAA
Seal    ATTATCTCACTTATACTAACCACGAAACTCACCCACACAAGTACAATAGACGCACAAGAA
Whale   ATTATTACCCTAATGCTTACAACCAAATTAACACATACTAGTACAATAGACGCCCAAGAA
Frog    ATTATTACTATTATAATAACTACTAAACTAACTAATACAAACCTAATGGACGCACAAGAG

Cow     GTAGAGACAATCTGAACCATTCTGCCCGCCATCATCTTAATTCTAATTGCTCTTCCTTCT
Carp    ATCGAAATCGTATGAACCATTCTACCAGCCGTCATTTTAGTACTAATCGCCCTGCCCTCC
Chicken GTTGAACTAATCTGAACCATCCTACCCGCTATTGTCCTAGTCCTGCTTGCCCTCCCCTCC
Human   ATAGAAACCGTCTGAACTATCCTGCCCGCCATCATCCTAGTCCTCATCGCCCTCCCATCC
Loach   ATTGAAATCGTATGAACTGTGCTCCCTGCCCTAATCCTCATTTTAATCGCCCTCCCCTCA
Mouse   GTTGAAACCATTTGAACTATTCTACCAGCTGTAATCCTTATCATAATTGCTCTCCCCTCT
Rat     GTAGAAACAATTTGAACAATTCTCCCAGCTGTCATTCTTATTCTAATTGCCCTTCCCTCC
Seal    GTGGAAACGGTGTGAACGATCCTACCCGCTATCATTTTAATTCTCATTGCCCTACCATCA
Whale   GTAGAAACTGTCTGAACTATCCTCCCAGCCATTATCTTAATTTTAATTGCCTTGCCTTCA
Frog    ATCGAAATAGTGTGAACTATTATACCAGCTATTAGCCTCATCATAATTGCCCTTCCATCC

Cow     TTACGAATTCTATACATAATAGATGAAATCAATAACCCATCTCTTACAGTAAAAACCATA
Carp    CTACGCATCCTGTACCTTATAGACGAAATTAACGACCCTCACCTGACAATTAAAGCAATA
Chicken CTCCAAATCCTCTACATAATAGACGAAATCGACGAACCTGATCTCACCCTAAAAGCCATC
Human   CTACGCATCCTTTACATAACAGACGAGGTCAACGATCCCTCCCTTACCATCAAATCAATT
Loach   CTACGAATTCTATATCTTATAGACGAGATTAATGACCCCCACCTAACAATTAAGGCCATG
Mouse   CTACGCATTCTATATATAATAGACGAAATCAACAACCCCGTATTAACCGTTAAAACCATA
Rat     CTACGAATTCTATACATAATAGACGAGATTAATAACCCAGTTCTAACAGTAAAAACTATA
Seal    TTACGAATCCTCTACATAATGGACGAGATCAATAACCCTTCCTTGACCGTAAAAACTATA
Whale   TTACGGATCCTTTACATAATAGACGAAGTCAATAACCCCTCCCTCACTGTAAAAACAATA
Frog   CTTCGTATCCTATATTTAATAGATGAAGTTAATGATCCACACTTAACAATTAAAGCAATC

Cow     GGACATCAGTGATACTGAAGCTATGAGTATACAGATTATGAGGACTTAAGCTTCGACTCC
Carp    GGACACCAATGATACTGAAGTTACGAGTATACAGACTATGAAAATCTAGGATTCGACTCC
Chicken GGACACCAATGATACTGAACCTATGAATACACAGACTTCAAGGACCTCTCATTTGACTCC
Human   GGCCACCAATGGTACTGAACCTACGAGTACACCGACTACGGCGGACTAATCTTCAACTCC
Loach   GGGCACCAATGATACTGAAGCTACGAGTATACTGATTATGAAAACTTAAGTTTTGACTCC
Mouse   GGGCACCAATGATACTGAAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCA
Rat     GGACACCAATGATACTGAAGCTATGAATATACTGACTATGAAGACCTATGCTTTGACTCC
Seal    GGACATCAGTGATACTGAAGCTATGAGTACACAGACTACGAAGACCTGAACTTTGACTCA
Whale   GGTCACCAATGATATTGAAGCTATGAGTATACCGACTACGAAGACCTAAGCTTCGACTCC
Frog    GGCCACCAATGATACTGAAGCTACGAATATACTAACTATGAGGATCTCTCATTTGACTCT

Cow     TACATAATTCCAACATCAGAATTAAAGCCAGGGGAGCTACGACTATTAGAAGTCGATAAT
Carp    TATATAGTACCAACCCAAGACCTTGCCCCCGGACAATTCCGACTTCTGGAAACAGACCAC
Chicken TACATAACCCCAACAACAGACCTCCCCCTAGGCCACTTCCGCCTACTAGAAGTCGACCAT
Human   TACATACTTCCCCCATTATTCCTAGAACCAGGCGACCTGCGACTCCTTGACGTTGACAAT
Loach   TACATAATCCCCACCCAGGACCTAACCCCTGGACAATTCCGGCTACTAGAGACAGACCAC
Mouse   TATATAATCCCAACAAACGACCTAAAACCTGGTGAACTACGACTGCTAGAAGTTGATAAC
Rat     TACATAATCCCAACCAATGACCTAAAACCAGGTGAACTTCGTCTATTAGAAGTTGATAAT
Seal    TATATGATCCCCACACAAGAACTAAAGCCCGGAGAACTACGACTGCTAGAAGTAGACAAT
Whale   TATATAATCCCAACATCAGACCTAAAGCCAGGAGAACTACGATTATTAGAAGTAGATAAC
Frog    TATATAATTCCAACTAATGACCTTACCCCTGGACAATTCCGGCTGCTAGAAGTTGATAAT

Cow     CGAGTTGTACTACCAATAGAAATAACAATCCGAATGTTAGTCTCCTCTGAAGACGTATTA
Carp    CGAATAGTTGTTCCAATAGAATCCCCAGTCCGTGTCCTAGTATCTGCTGAAGACGTGCTA
Chicken CGCATTGTAATCCCCATAGAATCCCCCATTCGAGTAATCATCACCGCTGATGACGTCCTC
Human   CGAGTAGTACTCCCGATTGAAGCCCCCATTCGTATAATAATTACATCACAAGACGTCTTG
Loach   CGAATGGTTGTTCCCATAGAATCCCCTATTCGCATTCTTGTTTCCGCCGAAGATGTACTA
Mouse   CGAGTCGTTCTGCCAATAGAACTTCCAATCCGTATATTAATTTCATCTGAAGACGTCCTC
Rat     CGGGTAGTCTTACCAATAGAACTTCCAATTCGTATACTAATCTCATCCGAAGACGTCCTG
Seal    CGAGTAGTCCTCCCAATAGAAATAACAATCCGCATACTAATCTCATCAGAAGATGTACTC
Whale   CGAGTTGTCTTACCTATAGAAATAACAATCCGAATATTAGTCTCATCAGAAGACGTACTC
Frog    CGAATAGTAGTCCCAATAGAATCTCCAACCCGACTTTTAGTTACAGCCGAAGACGTCCTC

Cow     CACTCATGAGCTGTGCCCTCTCTAGGACTAAAAACAGACGCAATCCCAGGCCGTCTAAAC
Carp    CATTCTTGAGCTGTTCCATCCCTTGGCGTAAAAATGGACGCAGTCCCAGGACGACTAAAT
Chicken CACTCATGAGCCGTACCCGCCCTCGGGGTAAAAACAGACGCAATCCCTGGACGACTAAAT
Human   CACTCATGAGCTGTCCCCACATTAGGCTTAAAAACAGATGCAATTCCCGGACGTCTAAAC
Loach   CACTCCTGGGCCCTTCCAGCCATGGGGGTAAAGATAGACGCGGTCCCAGGACGCCTTAAC
Mouse   CACTCATGAGCAGTCCCCTCCCTAGGACTTAAAACTGATGCCATCCCAGGCCGACTAAAT
Rat     CACTCATGAGCCATCCCTTCACTAGGGTTAAAAACCGACGCAATCCCCGGCCGCCTAAAC
Seal    CACTCATGAGCCGTACCGTCCCTAGGACTAAAAACTGATGCTATCCCAGGACGACTAAAC
Whale   CACTCATGGGCCGTACCCTCCTTGGGCCTAAAAACAGATGCAATCCCAGGACGCCTAAAC
Frog    CACTCGTGAGCTGTACCCTCCTTGGGTGTCAAAACAGATGCAATCCCAGGACGACTTCAT

Cow     CAAACAACCCTTATATCGTCCCGTCCAGGCTTATATTACGGTCAATGCTCAGAAATTTGC
Carp    CAAGCCGCCTTTATTGCCTCACGCCCAGGGGTCTTTTACGGACAATGCTCTGAAATTTGT
Chicken CAAACCTCCTTCATCACCACTCGACCAGGAGTGTTTTACGGACAATGCTCAGAAATCTGC
Human   CAAACCACTTTCACCGCTACACGACCGGGGGTATACTACGGTCAATGCTCTGAAATCTGT
Loach   CAAACCGCCTTTATTGCCTCCCGCCCCGGGGTATTCTATGGGCAATGCTCAGAAATCTGT
Mouse   CAAGCAACAGTAACATCAAACCGACCAGGGTTATTCTATGGCCAATGCTCTGAAATTTGT
Rat     CAAGCTACAGTCACATCAAACCGACCAGGTCTATTCTATGGCCAATGCTCTGAAATTTGC
Seal    CAAACAACCCTAATAACCATACGACCAGGACTGTACTACGGTCAATGCTCAGAAATCTGT
Whale   CAAACAACCTTAATATCAACACGACCAGGCCTATTTTATGGACAATGCTCAGAGATCTGC
Frog    CAAACATCATTTATTGCTACTCGTCCGGGAGTATTTTACGGACAATGTTCAGAAATTTGC

Cow     GGGTCAAACCACAGTTTCATACCCATTGTCCTTGAGTTAGTCCCACTAAAGTACTTTGAA
Carp    GGAGCTAATCACAGCTTTATACCAATTGTAGTTGAAGCAGTACCTCTCGAACACTTCGAA
Chicken GGAGCTAACCACAGCTACATACCCATTGTAGTAGAGTCTACCCCCCTAAAACACTTTGAA
Human   GGAGCAAACCACAGTTTCATGCCCATCGTCCTAGAATTAATTCCCCTAAAAATCTTTGAA
Loach   GGAGCAAACCACAGCTTTATACCCATCGTAGTAGAAGCGGTCCCACTATCTCACTTCGAA
Mouse   GGATCTAACCATAGCTTTATGCCCATTGTCCTAGAAATGGTTCCACTAAAATATTTCGAA
Rat     GGCTCAAATCACAGCTTCATACCCATTGTACTAGAAATAGTGCCTCTAAAATATTTCGAA
Seal    GGTTCAAACCACAGCTTCATACCTATTGTCCTCGAATTGGTCCCACTATCCCACTTCGAG
Whale   GGCTCAAACCACAGTTTCATACCAATTGTCCTAGAACTAGTACCCCTAGAAGTCTTTGAA
Frog    GGAGCAAACCACAGCTTTATACCAATTGTAGTTGAAGCAGTACCGCTAACCGACTTTGAA

Cow     AAATGATCTGCGTCAATATTA---------------------TAA
Carp    AACTGATCCTCATTAATACTAGAAGACGCCTCGCTAGGAAGCTAA
Chicken GCCTGATCCTCACTA------------------CTGTCATCTTAA
Human   ATA---------------------GGGCCCGTATTTACCCTATAG
Loach   AACTGGTCCACCCTTATACTAAAAGACGCCTCACTAGGAAGCTAA
Mouse   AACTGATCTGCTTCAATAATT---------------------TAA
Rat     AACTGATCAGCTTCTATAATT---------------------TAA
Seal    AAATGATCTACCTCAATGCTT---------------------TAA
Whale   AAATGATCTGTATCAATACTA---------------------TAA
Frog    AACTGATCTTCATCAATACTA---GAAGCATCACTA------AGA
;
end;